Tìm kiếm
Đang tải khung tìm kiếm
Kết quả 1 đến 1 của 1

    THẠC SĨ Nghiên cứu phát hiện sự gắn chèn gene E6 và E7 của Human papilomavirus type 16 vào bộ gene người bằn

    D
    dream dream Đang Ngoại tuyến (18495 tài liệu)
    .:: Cộng Tác Viên ::.
  1. Gửi tài liệu
  2. Bình luận
  3. Chia sẻ
  4. Thông tin
  5. Công cụ
  6. Nghiên cứu phát hiện sự gắn chèn gene E6 và E7 của Human papilomavirus type 16 vào bộ gene người bằn

    LỜI CẢM ƠN
    Để hoàn tất khóa luận này, tôi xin bày tỏ lòng cảm ơn chân thành và sâu
    sắc tới:
    Lãnh đạo trường Đại học Tây Nguyên, các phòng ban và khoa chức năng
    đã tổ chức Đào tạo, quản lý và tạo điều kiện thuận cho tôi hoàn tất khóa học và
    luận văn. Các Thầy, Cô giáo trong và ngoài trường đã nhiệt tình giảng dạy và
    cung cấp những kiến thức quý báu trong suốt khóa học.
    TS. Võ Thị Phương Khanh, người luôn quan tâm, nhiệt tình hướng dẫn và
    tạo mọi điều kiện thuận lợi để tôi hoàn thành khóa luận.
    PGS. TS Nguyễn Anh Dũng đã có những trao đổi quý báu và tạo điều
    kiện thuận lợi để tôi hoàn thành khóa luận.
    Bộ môn SHTN, Bộ môn Sinh học thực vật và Phòng thí nghiệm
    CNSH&MT là các đơn vị đã tạo điều kiện thuận lợi để tôi thực hiện và hoàn tất
    khóa luận.
    Các anh, chị và các bạn học viên lớp Cao học SHTNK3; đã luôn quan
    tâm, chia sẻ và động viên tôi trong suốt khóa học cũng như suốt thời gian thực
    hiện khoa luận. Đặc biệt là bạn Hưng (Công ty CP TBR) đã nhiệt tình và có
    những trao đổi quý báu trong quá trình thực hiện đề tài; phòng Dịch vụ, Công ty
    Việt Á đã cung cấp chủng vi sinh vật tham khảo. Cô Giang (phòng khám đa
    khoa Nguyễn Dũng), anh Nguyện (phòng khám đa khoa Hồng Đức), bạn Việt
    (Bệnh viện đa khoa Thiện Hạnh), Cô Oanh (BS sản khoa, phòng khám số 120
    Hồ Tùng Mậu) và các anh chị tại phòng xét nghiệm Bệnh viện đa khoa Thiện
    Hạnh, phòng khám đa khoa Nguyễn Dũng, phòng khám số 120 Hồ Tùng Mậu,
    phòng khám số 46 Phan Chu Trinh, phòng khám đa khoa Hồng Đức đã nhiệt tình
    giúp đỡ tôi trong quá trình thu thập mẫu dịch phết cổ tử cung. iii
    Cuối cùng, xin gửi lời cảm ơn chân thành nhất tới những người thân trong
    gia đình đã luôn quan tâm, động viên tôi trong suốt quá trình học tập cũng như
    thực hiện luận văn.
    Buôn Ma Thuột, ngày tháng năm 2011
    Tác giả
    Trần Minh Định iv
    MỤC LỤC
    Trang
    MỞ ĐẦU 1
    1. Tính cấp thiết của đề tài 1
    2. Mục tiêu của đề tài 2
    3. Ý nghĩa khoa học . 2
    4. Ý nghĩa thực tiễn . 2
    Phần I TỔNG QUAN TÀI LIỆU 3
    1.1. Định nghĩa ung thư cổ tử cung 3
    1.2. Tác nhân gây ung thư cổ tử cung 4
    1.21. Tác nhân . 4
    1.2.2. Các type của Human papillomavirus . 4
    1.2.3. Bộ gen của virus HPV type 16 . 5
    1.2.4. Sự xâm nhiễm về mặt phân tử - hiện tượng chèn gen của virus HPV
    nguy cơ cao vào bộ gen người . 6
    1.2.5. Tình hình nghiên cứu gắn chèn gen E6 và E7 của HPV vào bộ gen
    người hiện nay . 9
    1.3. Tình hình bệnh ung thư cổ tử cung trên thế giới và Việt Nam . 11
    1.3.1. Tình hình bệnh ung thư cổ tử cung trên thế giới . 11
    1.3.2. Tình hình bệnh ung thư cổ tử cung tại Việt Nam . 12
    1.4. Các phương pháp phổ biến chuẩn đoán ung thư cổ tử cung hiện nay 13
    1.4.1. Chẩn đoán lâm sàng . 13
    1.4.2. Các phương pháp chẩn đoán dựa trên tế bào cổ tử cung . 14
    1.4.3. Các phương pháp chuẩn đoán tác nhân HPV gây ung thư cổ tử cung . 15
    1.5. Phương pháp RT – PCR trong chuẩn đoán gắn chèn gen gây ung thư cổ
    tử cung . 19
    1.6. Các phương pháp điều trị tổn thương tiền ung thư và ung thư cổ tử cung . 20
    1.6.1. Điều trị tổn thương tiền ung thư cổ tử cung . 20
    1.6.2. Điều trị ung thư cổ tử cung 21 v
    1.7. Các loại vaccine phòng HPV hiện nay 21
    Phần II NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU . 23
    2.1. Nội dung nghiên cứu 23
    2.2. Địa điểm và thời gian nghiên cứu . 23
    2.2.1. Địa điểm nghiên cứu 23
    2.2.2. Thời gian nghiên cứu . 23
    2.3. Vật liệu, hóa chất, dụng cụ và thiết bị nghiên cứu . 23
    2.3.1. Vật liệu nghiên cứu 24
    2.3.2. Hoá chất nghiên cứu 25
    2.3.3. Dụng cụ, thiết bị nghiên cứu 27
    2.3.3.1. Dụng cụ nghiên cứu 27
    2.3.3.2. Thiết bị nghiên cứu . 27
    2.4. Phương pháp nghiên cứu 28
    2.4.1. Phương pháp thiết kế và kiểm tra mồi 28
    2.4.1.1. Thiết kế và kiểm tra mồi 28
    2.4.1.2. Đánh giá khả năng khuếch đại của hệ mồi thiết kế 30
    2.4.1.3. Giải trình tự kiểm tra sản phẩm khuếch đại . 30
    2.4.2. Phương pháp thu và bảo quản mẫu bệnh phẩm 31
    2.4.3. Phương pháp tách chiết tế bào thu nhận RNA tổng số 31
    2.4.4. Phương pháp kiểm soát nội phản ứng 32
    2.4.5. Phương pháp multiplex RT – PCR 33
    2.4.5.1. Phản ứng RT . 33
    2.4.5.2. Phản ứng multiplex PCR . 33
    2.4.6. Phương pháp điện di kiểm tra sản phẩm multiplex RT – PCR 34
    2.4.7. Phương pháp xây dựng quy trình phát hiện gắn chèn gen E6 và E7 của
    HPV type 16 vào bộ gen người bằng kỹ thuật multiplex RT-PCR . 35
    2.4.7.1. Nghiên cứu nồng độ enzym DNase I xử lý dịch sau tách chiết thu
    nhận hoàn toàn RNA tổng số . 35
    2.4.7.2. Khảo sát nhiệt độ lai của hệ mồi . 36 vi
    2.4.7.3. Khảo sát nồng độ mồi . 36
    2.4.7.4. Khảo sát nồng độ Mg 2+ . 39
    2.4.7.5. Khảo sát nồng độ dNTP 39
    2.4.7.6. Khảo sát độ nhạy của quy trình . 39
    2.4.7.7. Khảo sát độ đặc hiệu của quy trình . 40
    2.4.9. Bước đầu ứng dụng quy trình phát hiện gắn chèn gen E6 và E7 của
    HPV type 16 vào bộ gen người bằng kỹ thuật multiplex RT-PCR trên các
    mẫu bệnh phẩm thu thập tại Tp. Buôn Ma Thuột . 40
    Phần III KẾT QUẢ VÀ THẢO LUẬN 41
    3.1. Nghiên cứu thiết kế và kiểm tra mồi khuếch đại đặc hiệu gen E6 và E7
    của HPV type 16 . 41
    3.1.1. Thiết kế và kiểm tra mồi 41
    3.1.2. Đánh giá khả năng khuếch đại của hệ mồi thiết kế . 44
    3.1.3. Giải trình tự kiểm tra sản phẩm khuếch đại 45
    3.2. Xây dựng quy trình phát hiện gắn chèn gen E6 và E7 của HPV type 16
    vào bộ gen người bằng kỹ thuật multiplex RT-PCR 47
    3.2.1. Nghiên cứu nồng độ enzym DNase I xử lý dịch mẫu sau tách chiết 47
    3.2.2. Khảo sát nhiệt độ lai của hệ mồi 49
    3.2.3. Khảo sát nồng độ mồi trong phản ứng PCR . 50
    3.2.4. Khảo sát nồng độ Mg 2+ 54
    3.2.5. Khảo sát nồng độ dNTP . 55
    3.2.6. Khảo sát độ nhạy của quy trình 56
    3.2.7. Khảo sát độ đặc hiệu của quy trình 57
    3.2.8. Quy trình phát hiện gắn chèn gen E6 và E7 của HPV type 16 vào bộ
    gen người bằng kỹ thuột multiplex RT-PCR 58
    3.3. Bước đầu ứng dụng quy trình phát hiện gắn chèn gen E6 và E7 của HPV
    type 16 vào bộ gen người bằng kỹ thuật multiplex RT-PCR trên các mẫu dịch
    phết cổ tử cung thu thập tại Tp. Buôn Ma Thuột 60 vii
    Phần IV KẾT LUẬN VÀ KIẾN NGHỊ 65
    4.1. Kết luận 65
    4.2. Kiến nghị 66
    TÀI LIỆU THAM KHẢO .
    PHỤ LỤC . viii
    CÁC CHỮ VIẾT TẮT
    AIDS Acquired Immune Deficiency Syndrome: Hội chứng suy
    giảm miễn dịch mắc phải ở người.
    BLAST Basic Local Alignment Search Tool: Công cụ tìm kiếm
    các trình tự tương đồng.
    Bp base pairs: Cặp base
    CIN Cervical Intraepithelial Neoplasia: Tổn thương trong tế
    bào biểu mô cổ tử cung.
    Cs Cộng sự
    CD Chứng dương
    cDNA complementary DNA: DNA bổ sung
    dATP Deoxyadenosine triphosphate
    dCTP Deoxycytidine triphosphate
    DEPC Diethylpyrocarbonate
    dGTP Deoxyguanosine triphosphate
    DNA Deoxyribonucleic acid
    dNTP Deoxyribonucleotide triphotphate
    dTTP Deoxythymidine triphosphate
    EDTA ethylenediaminetetraacetic acid
    EMBL European Molecular Biology Labolatories: Hội các
    phòng thí nghiệm Sinh học phân tử Châu Âu.
    HPV Human Papilomavirus
    IARC International Agenecy For Research on Cancer
    IDT Intergrated DNA Technology
    Kb Kilo base
    mRNA Messenger Ribonucleotide acid
    NCBI National Center for Biotechnology Information: Trung
    tâm Quốc gia về thông tin Công nghệ Sinh học. ix
    PCR Polymerase chain reaction: Phản ứng kéo dài chuỗi.
    PK Phòng khám
    PKĐK Phòng khám đa khoa
    RNA Ribonucleotide acid
    RT Reverse Transcriptase
    RT-PCR Reverse Transcriptase - Polymerase chain reaction
    TAE Tris acetate EDTA
    Taq Thermus aquaticus
    TE Tris acid – EDTA
    Tm melting Temperature: Nhiệt độ biến tính. x
    DANH MỤC CÁC HÌNH ẢNH
    Trang
    Hình 1.1: Sự phát triển của các tế bào bất thường trong bệnh ung thư cổ tử
    cung 3
    Hình 1.2: Human papillomavirus type 16 4
    Hình 1.3: Cấu trúc bộ gene của Human papillomavirus type 16 5
    Hình 1.4: Quá trình xâm nhiễm và gây bệnh của HPV type nguy cơ cao trong
    tế bào chủ 7
    Hình 1.5: Sơ đồ biểu diễn phân bố tỉ lệ ung thư cổ tử cung trên thế giới 10
    Hình 1.6: Tế bào cổ tử cung bình thường và nghịch sản 13
    Hình 2.1: Thang DNA 100bp 26
    Hình 2.2: Sơ đồ biểu thị vị trí gắn mồi E6f-E6r trên gene E6 và trên amplicon 31
    Hình 3.1: Kết quả đánh giá khả năng khuếch đại của hệ mồi thiết kế . 44
    Hình 3.2: Kết quả thực hiện phản ứng multiplex PCR trên 3 mẫu chứng
    dương chưa xử lý enzym DNase I . 45
    Hình 3.3: Kết quả khảo sát nồng độ enzym DNase I xử lý dịch sau tách chiết 47
    Hình 3.4: Kết quả khảo sát nhiệt độ lai của hệ mồi 47
    Hình 3.5: Kết quả khảo sát nồng độ hệ mồi trong phản ứng . 48
    Hình 3.6: Kết quả khảo sát nồng độ Mg 2+ 52
    Hình 3.7: Kết quả khảo sát nồng độ dNTP . 53
    Hình 3.8: Kết quả khảo sát độ nhạy của quy trình 54
    Hình 3.9: Kết quả khảo sát độ đặc hiệu của quy trình 55
    Hình 3.10: Kết quả kiểm chứng quy trình phát hiện gắn chèn gene E6 và E7 của
    HPV type 16 vào bộ gene người trên các mẫu dịch phết cổ tử cung thu thập tại Tp.
    Buôn Ma Thuột 61 xi
    DANH MỤC CÁC BẢNG
    Trang
    Bảng 1.1: Tỷ lệ tiến triển của các giai đoạn CIN sang ung thư cổ tử cung . 9
    Bảng 1.2: Các phương pháp điều trị tổn thương tiền ưng thư cổ tử cung . 19
    Bảng 2.1: Các chủng vi sinh vật và mẫu bệnh phẩm tham khảo sử sụng trong
    đề tài . 23
    Bảng 2.2: Địa điểm và số lượng mẫu thu thập sử dụng trong đề tài . 24
    Bảng 2.3: Trình tự amplicon tổng hợp làm chứng nội 24
    Bảng 2.4: Nồng độ của 2 cặp mồi khảo sát trong đề tài . 36
    Bảng 3.1: Kết quả thiết kế mồi 41
    Bảng 3.2: Đặc tính của hệ mồi thiết kế 42
    Bảng 3.3: Cấu trúc thứ cấp của hệ mồi thiết kế 42
    Bảng 3.4: Cấu trúc hetero-dimer (kcal/mole) của hệ mồi thiết kế 42
    Bảng 3.5: Kết quả khảo sát nhiệt độ lai của hệ mồi 48
    Bảng 3.6: Kết quả khảo sát nồng độ hệ mồi trong phản ứng 49
    Bảng 3.7: Kết quả khảo sát độ nhạy của quy trình . 54
    Bảng 3.8: Sơ đồ quy trình phát hiện gắn chèn gene E6 và E7 của HPV type 16
    vào bộ gene người bằng kỹ thuột multiplex RT-PCR 56
    Bảng 3.9: Kết quả giải trình tự gene E6 và E7 của HPV type 16 gắn chèn vào bộ gene
    người 58
    Bảng 3.10: Kết quả kiểm chứng quy trình phát hiện gắn chèn gene E6 và E7 của
    HPV type 16 vào bộ gene người trên các mẫu dịch phết cổ tử cung thu thập tại Tp.
    Buôn Ma Thuột 62 23
    Phần II NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU
    2.1. Nội dung nghiên cứu
    1. Nghiên cứu thiết kế và kiểm tra mồi khuếch đại đặc hiệu gen E6 và E7 của
    HPV type 16.
    2. Xây dựng quy trình phát hiện sự gắn chèn gen E6 và E7 của HPV type 16
    vào bộ gen người bằng kỹ thuật multiplex RT-PCR
    - Nghiên cứu nồng độ enzym DNase I xử lý dịch sau tách chiết
    - Khảo sát nhiệt độ lai của hệ mồi
    - Khảo sát nồng độ mồi
    - Khảo sát nồng độ Mg 2+
    - Khảo sát nồng độ dNTP
    - Khảo sát độ nhạy của quy trình
    - Khảo sát độ đặc hiệu của quy trình
    3. Bước đầu ứng dụng quy trình phát hiện gắn chèn gen E6 và E7 của HPV
    type 16 vào bộ gen người bằng kỹ thuật multiplex RT-PCR trên các mẫu mẫu dịch
    phết cổ tử cung thu thập tại Tp. Buôn Ma Thuột.
    2.2. Địa điểm và thời gian nghiên cứu
    2.2.1. Địa điểm nghiên cứu
    - Phòng thí nghiệm Sinh học phân tử - Bộ môn Sinh học thực nghiệm, Khoa
    KHTN&CN, trường Đại học Tây Nguyên.
    - Phòng thí nghiệm CNSH&MT, trường Đại học Tây Nguyên.
    2.2.2. Thời gian nghiên cứu
    Đề tài thực hiện từ tháng 09/2010 tới tháng 08/2011.
    2.3. Vật liệu, hóa chất, dụng cụ và thiết bị nghiên cứu 24
    2.3.1. Vật liệu nghiên cứu
    + Mẫu chứng dương: 3 mẫu chứng dương (CD1, CD2, CD3) là mẫu bệnh
    phẩm thu nhận từ bệnh nhân ung thư cổ tử cung đã được xác định do HPV type 16
    gây ra, được cung cấp từ Khoa Ung bướu, Bệnh viện Đa khoa Cần Thơ.
    + 8 chủng vi sinh vật và 1 mẫu bệnh phẩm sử sụng trong đề tài
    Bảng 2.1: Các chủng vi sinh vật và mẫu bệnh phẩm sử sụng trong đề tài
    STT Tên vi sinh vật Nguồn gốc Số lượng
    1
    DNA của người không bị
    ung thư cổ tử cung
    Khoa Ung bướu, Bệnh viện
    đa khoa Cần Thơ
    1
    2 HPV type 18
    Công ty cổ phần công nghệ
    Việt Á, Tp. Hồ Chí Minh
    1
    3 HPV type 11 1
    4 HPV type 6 1
    5 HPV type 33 1
    6 HPV type 45 1
    7 E.coli 1
    8 Chlamydia trachomatis 1
    9 Neisseria gonorrhoeae 1
    + Mẫu chứng âm: nước cất.
    + 86 mẫu bệnh phẩm dịch phết cổ tử cung thu thập tại Tp. Buôn Ma Thuột –
    Đăk Lăk.
    Bảng 2.2: Địa điểm và số lượng mẫu thu thập sử dụng trong đề tài
    STT Địa điểm thu mẫu Số mẫu thu thập
    1 Bệnh viện đa khoa Thiện Hạnh 64
    2 Phòng khám đa khoa Hồng Đức 2 25
    3 Phòng khám số 46 Phan Chu Trinh 2
    4 Phòng khám đa khoa Nguyễn Dũng 7
    5 Phòng khám số 120 Hồ Tùng Mậu 11
    Tổng cộng 86
    + Chứng nội: là yếu tố kiểm soát nội phản ứng nhằm kiểm chứng phản ứng
    có diễn ra bình thường hay không. Một đoạn amplicon có kích thước 400bp được
    tổng hợp tại Công ty IDT (Hoa Kỳ) dùng làm chứng nội, trình tự amplicon được
    thiết kế với 2 vị trí lỗi (mismatch) thể hiện qua bảng 2.3
    Bảng 2.3: Trình tự amplicon tổng hợp làm chứng nội
    Trình tự amplicon (5’ – 3’)
    Kích
    thước (bp)
    CACAGAGCTGCAAACAACTATCCAATTATCAACAATTACTACAT
    GCAGCAGTACCAGAACTCCATGGACACGCAGCTTGGTGACAACG
    CTATTAGCGGAGGCTCCAACGAGGGGTCCACGGACACCACCTCC
    ACTCACACAACCAACACTCAGAACAATGACTGGTTTTCAAAGCT
    GACCAGTTCCGCTTTTAGCGGTCTTTTCGGCGCTCTTCTTGCTGAC
    AAGAAAACCGAGGAGACCACTCTTCTCGAGGACCGCATCCTCAC
    TACCCGCAACGGACACACGACCTCGACAACCCAGTCGAGCGTTG
    GAGTCACTTACGGGTACGCAACAGCTGAGGACTTTGTGAGCGGA
    CCAAACACATCTGGGCTTGAGACCAACCGTCAAAAGCCACTGTG
    TC
    400
    Ghi chú: C vị trí mismatch trên amplicon
    2.3.2. Hoá chất nghiên cứu
    + Hóa chất dùng cho tách chiết tế bào thu nhận RNA tổng số
    - Dung dịch 1 (Trizol X100): phenol 38%, guanidium thyocianate 0.8M,
    glycerol 5%, chỉnh về pH 4.0.
    - Dung dịch 2: Chloroform.

    Xem Thêm: Nghiên cứu phát hiện sự gắn chèn gene E6 và E7 của Human papilomavirus type 16 vào bộ gene người bằn
    Nội dung trên chỉ thể hiện một phần hoặc nhiều phần trích dẫn. Để có thể xem đầy đủ, chi tiết và đúng định dạng tài liệu, bạn vui lòng tải tài liệu. Hy vọng tài liệu Nghiên cứu phát hiện sự gắn chèn gene E6 và E7 của Human papilomavirus type 16 vào bộ gene người bằn sẽ giúp ích cho bạn.
    #1
  7. Đang tải dữ liệu...

    Chia sẻ link hay nhận ngay tiền thưởng
    Vui lòng Tải xuống để xem tài liệu đầy đủ.

    Gửi bình luận

    ♥ Tải tài liệu

social Thư Viện Tài Liệu

Từ khóa được tìm kiếm

Nobody landed on this page from a search engine, yet!

Quyền viết bài

  • Bạn Không thể gửi Chủ đề mới
  • Bạn Không thể Gửi trả lời
  • Bạn Không thể Gửi file đính kèm
  • Bạn Không thể Sửa bài viết của mình
  •  
DMCA.com Protection Status